Creation vs. Evolution

[ekremer]

This just in: E. Coli Evolve to digest Citrate. No longer E. Coli?
Bacteria make major evolutionary shift in the lab - life - 09 June 2008 - New Scientist

 

[Thalassamania]

This just in: E. Coli Evolve to digest Citrate. No longer E. Coli?
Bacteria make major evolutionary shift in the lab - life - 09 June 2008 - New Scientist

Thanks ... from the end of the paper:

"... the experiment stands as proof that evolution does not always lead to the best possible outcome. Instead, a chance event can sometimes open evolutionary doors for one population that remain forever closed to other populations with different histories."

​

I suspect the almost every item we have covered can be found in one of the two lists below.

Misconceptions about evolution:

1. Everything is an adaptation produced by natural selection
2. Natural selection is the only means of evolution
3. Natural selection leads to ever-greater complexity
4. Evolution produces creatures perfectly adapted to their environment
5. Evolution always promotes the survival of species
6. It doesn't matter if people do not understand evolution
7. "Survival of the fittest" justifies "everyone for themselves"
8. Evolution is limitlessly creative
9. Evolution cannot explain traits such as homosexuality
10. Creationism provides a coherent alternative to evolution

Creationist myths:

1. Evolution must be wrong because the Bible is inerrant
2. Accepting evolution undermines morality
3. Evolutionary theory leads to racism and genocide
4. Religion and evolution are incompatible
5. Half a wing is no use to anyone
6. Evolutionary science is not predictive
7. Evolution cannot be disproved so is not science
8. Evolution is just so unlikely to produce complex life forms
9. Evolution is an entirely random process
10. Mutations can only destroy information, not create it
11. Darwin is the ultimate authority on evolution
12. The bacterial flagellum is irreducibly complex
13. Yet more creationist misconceptions
14. Evolution violates the second law of thermodynamics

Shall we just answer by number in the future?

Instant Expert: Evolution

 

[Warthaug]

Nylon digesting bacteria also had decreased functionality in consuming other foods.

Depends on which ones you are referring to, as over a dozen nylon metabolizing strains have been described so far. Several have been classified which show no decrease in fitness; including many strains which evolved in nature that not only compete on equal footing with their progenitor strains, but actually outcompete them.

Negoro et al, 1994. "The nylon oligomer biodegradation system of Flavobacterium and Pseudomonas." Biodegradation 5:185-194

You are wrong on "information."

No, actually I am not. There is no way to quantify "information", that is a well established principal in science. The reason is simple - information is essentially in the eye of the beholder, meaning there is no objective way to quantify it. Simple example, which of the following DNA sequences have more information:

1) TAGCGTGCTAATTGTGGTGTTACTTAA
2) CACAGTGCTAATTGTGGTGTTACTTAA, or
3) ATGAGTGCTTAATTGTGGTGTTACTTAA?

The answer is - well it depends on context. Your options are:
a) #3, as it has more letters,
b) #1 and #2, as they both encode 8 amino acids each (#3 encodes 2 amino acids)
c) #3, as it has a start codon and thus is the only one which would be expressed
d) All are equal, as they consist of the same 4 parts (A,T,C & G)
e) None of the above

All five answers are correct, depending on context, so how much information is there?

Yes, protein amounts are increased, but proteins are the result of the information encoded within the DNA, and not the information themselves. Gene duplication does not, in fact, add information. Two copies of the same magazine do not increase any information...you simply have twice as must of the same information, hence your requirement for gene duplication followed by mutation

And once again, we see how important context is. While two copies of the same book do not have 2x the information of a copy of the book, using multiple copies of the same word in one text can greatly add to the information in the book; even though the book itself consists of hundreds of repetitions of the same book.

And I would point out (again) that arguing about information is pointless, as information is not an quantifiable thing. The closest you can get is "information entropy", a concept derived from the mathmatics of information theory. But in the way in which information theory quantifies "information", as applied to evolution, a gene duplication represents an increase in information, even in the absence of mutation:

Huelsenbeck, J. P., F. Ronquist, R. Nielsen and J. P. Bollback (2001) Bayesian inference of phylogeny and its impact on evolutionary biology, Science294:2310-2314

Mutations are degenerative in one way or another...mostly lethal.

Completely, and utterly false. The vast majority of mutations are neutral, meaning they are neither good, nor bad. This finding actually drove an alternate theory to evolution for many years (called, rather appropriately, neutralism). Of those mutations which are not neutral, the number which are beneficial vs. deleterious is nearly impossible to determine, as benefit vs. cost varies depending on selective pressure.

One needs look no farther then our own genome to see this. The haploid human genome has 3 billion base pairs. Humans accumulate mutations at a rate 20-30 point mutations per billion base pairs, resulting in 50-100 mutations per person. Because most of our DNA does not code for protein, this means that 3-4 (actual average is 3.75) of the mutations which occur in each human, in each generation, fall into protein-coding regions.

If mutations were always deleterious humans would die off in just a few generations; obviously this isn't the case. In fact, we have a pretty good idea of the rate that deleterious mutations form (about 1:5,000 individuals), meaning that:

• 1:5,0000 / 3.75 = 1:18,750 of mutations falling in protein coding regions are deleterious in humans, or
• 1:5,000 / 50-100 = 1:250,000 to 1:5,000,000 of all human mutations are deleterious
  

http://www.hapmap.org/

Nachman, Michael W. & Crowell, Susan L. 2000. Estimate of the Mutation Rate per Nucleotide in Humans. Genetics 156, 297-304

Kumar, Sudhir & Subramanian, Sankar. 2002. Mutation rates in mammalian genomes. Proceedings of the National Academy of Sciences of the United States of America.99, 803-808

Giannelli F, Anagnostopoulos T, Green PM (1999) Mutation rates in humans. II. Sporadic mutation-specific rates and rate of detrimental human mutations inferred from hemophilia B. Am J Hum Genet 65:1580–1587

Green PM, Saad S, Lewis CM, Giannelli F (1999) Mutation rates in humans. I. Overall and sex-specific rates obtained from a population study of hemophilia B. Am J Hum Genet 65:1572–1579

Kondrashov AS (1988) Deleterious mutations and the evolution of sexual reproduction. Nature 336:435–440
Giannelli F, Green PM. The X chromosome and the rate of deleterious mutations
in humans. Am J Hum Genet. 2000 Aug;67(2):515-7. Epub 2000 Jul 5.

You (plural) must bet your bank account that some rare benign mutation will at some point become beneficial.

As you can see in my example, and in the links provided above, that is complete nonsence. More likely then not, you'll have a neutral mutation (under past conditions) that become beneficial under a new selective pressure.

HIV drug resistance is also coupled with decreased reproductive functionality somehow.

I used to study HIV for a living, so I'd be very, very, very careful of what claims you try to make here as not only am I intimately aware of this literature, but I was directly involved in writing some of it. Its too bad you didn't get that warning earlier, as I already see you've repeated a huge pack of lies.

To start with, your first statement is completely false. All HIV infections start off with a patient only having one, or a few HIV variants. Over time, regardless of whether the HIV is treated or not, the number of HIV variants grows dramatically. Your average terminal-stage HIV patient will have dozens to hundreds of separate strains. These strains rise as a product of evolution of the virus, due to its interactions of the host (and drugs, if they are used). This evolutionary process results in the following:

1) Strains which are better able to replicate in the specific genetic background of the host.
2) Strains which are resistant to anti-HIV drugs
3) Strains with expanded cell trophy (all infections start as M-tropic, and evolve to T- and M/T trophy)
4) Strains with increase replicative rate

Note that most strains in terminal patients will have more then one of the above characteristics; some (unfortunately) take on all four.

All of the above result in a virus which is faster dividing, healthier, and overall more deadly to the patient. Direct assessment of the fitness of these viruses show that the evolutionary progression they undergo over the course of an infection can result in huge increases in their fitness:

Rousseau CM, et al. HLA Class-I Driven Evolution of Human Immunodeficiency Virus
Type 1 Subtype C Proteome: Immune Escape and Viral Load. J Virol. 2008 Apr 23.

Borggren M, et al. Evolution of DC-SIGN use revealed by fitness studies of R5 HIV-1
variants emerging during AIDS progression. Retrovirology. 2008 Mar 27;5:28.

There are 517 additional articles on this subject if you want them. And they all see
the same thing - increases in fitness as the virus evolves.

When patients are removed from the drugs, the remaining wild type viruses vastly out compete the mutated ones which of course implies that the resistance was coupled with some sort of loss of information

Actually, that is not the case. When drugs are removed some strains do expand faster than other. The strains which expand are rarely the initial form which infected the patient, and instead are strains which have undergone a significant degree of evolution in then host.

In the most severe cases - when patients repetitively go on and off their drugs (an all-to-common phenomina, BTW) we end up with "super-viruses" - viruses which are more infectious compared to the parental infection, which are drug resistant, and which kill of patients much faster than "normal" HIV:

Quan Y, Brenner BG, Dascal A, Wainberg MA. Highly diversified multiply drug-resistant
HIV-1 quasispecies in PBMCs: A case report. Retrovirology. 2008 May 30;5(1):43.

Kolber MA.Development of drug resistance mutations in patients on highly active
antiretroviral therapy: does competitive advantage drive evolution. AIDS Rev.
2007 Apr-Jun;9(2):68-74.

There's another 4422 articles on that subject, all of which show pretty much the same thing.

Similar evolutionary changes, driven by a combination of host-pathogen interactions
and drugs, have also been well characterized. Amoung these infections, where
evolution has produced fitter, and yet drug-resistant strains are:

TB
Flu
Malaria
HepC
HTLV-I/II
Salmonella
Camplyobacter
HepB

And I'm sure there are many, many more examples.

Supposed gene duplications in yeast typically involve dividing functions between genes whereas the supposed ancestor gene does all of it, as opposed to creating new functions.

Absolutely incorrect. Gene duplication, regardless of species, produces two copies of a gene, both of which are fully functional. Divergent evolution will then cause the function of one (or both) copies to change. In some cases two genes may take over the job of what used to be one; but in the vast majority of cases you get divergence - one gene taking on a new and different function.

Obviously more mutations would be required to eventually produce some new functionality. Of course both genes and proteins have multiple functions and so a mutation that optimizes one function of the gene would more than likely harm at least one other function of the gene...therefore mutations would be deleterious and selected against.

Its a nice hypothesis you have there, but it is incorrect. The data; a tiny portion of which I cited for you, clearly shows these processes occur in the way I described, and can and do drive evolution.

Bryan

 

[Warthaug]

Shall we just answer by number in the future?

If only it was that easy. But if history has shown us anything, most creationists don't even understand science well enough to be lead to the material numbered on that list...

Bryan

 

[Warthaug]

I don't think it sums it all up. His challenge...

I think you missed the part he was agreeing with. It is where I said this:

Until creationists can come up with an alternate theory that both explains all of the observation science has made to date about how life changes, and predicts future findings, creationism will always be treated as nothing more then an irrelevent piece of fundamentalist dogma. You can complain that its "naturalistic", "athiestic", or wahtever-istic you feel like, but at the end of the day your name-calling doesn't change the fact that it is the only theory out there which both predicts what we see in nature, and desacribes why we see it.

That is where the science is at - until creationism can do the same you're not even playing the same game.

As you can see, it has nothing to do with my challange.

His challenge is limited to competing theories based on a literal interpretation of the Bible. Is that representative of any theory that might be considered "creationist"?

Most would argue "yes". After all, most Christians (in terms of both numbers, and number of denominations) do not hold to a literalistic view of the bible, and as a result do not have the characteristic "problem" with evolution that many in this thread have expressed. On the contrary, many of those churches have accepted evolution - formally or informally - and you will find among their followers valued members of the scientific community.

The "conflict" exists purely between biblical literalistic and evolution, as only the literalistic don't have the flexibility in their faith to accept evolution as the way god "does it". Likewise, nearly all of the "alternatives" put forward as religiously acceptable versions all conform to what you see in genesis.

So no, I do not think I'm out of line in asking the creationists to come up with a theory that fits both their literalistic interpretation of genesis and the observations we've made in nature. It is, after all, the literalists driving the conflict, it is what the literalists are trying to force into schools using the most underhanded methods imaginable, and it is the literalists who have produced the thousands of anti-evolution webpages, books and videos.

Bryan

 

[Warthaug]

I don't think that's an accurate description of the position I've taken or what I've posted.

I have questioned quite a few things from red-shift to DNA evidence and the fossil record but I don't recall ever using the book of Genesis as my refernce point.

I think if you look back at my posts, you'll see that when I questioned the science I framed my discussion based on the science rather than the Bible.

Looking back I see you arguing both science and theology, oft in the same post...

Regardless, the end goal is the same - you want to disbelieve evolution, and so you look for excuses to do so.

Looking back at your posts, you've failed at two levels:

1) Most of your "points" about science were based on misunderstanding, or out-and-out twisting of sciences actual discoveries. As such you weren't pointing out holes in science, but rather pointed out holes in your understanding of science. I may have missed it, but I don't see any evidence that you managed to undermine even one aspect of science's findings.

2) Disproving evolution (or any other scientific principal) wouldn't magically make your religious beliefs correct. Scientific thoeries change all the time - its a central part of the scientific process. So, at absolute best, you may end up strengthening science by pointing out an incomplete problem which could then be solved. That gets you no closer to proving that creationism is correct - if anything, it'll add more evidence against creationism.

To prove that your religious view of how the universe arose, you need to do exactly what I asked - provide a theory which explains all of the data in the context of your creationist beliefs. Anything less than that means you're working from a framework which is a puny shadow of what evolutionary theory provides.

Bryan

 

[Thalassamania]

The telling point, in the long standing "conflict" between science and religion, is that it has always turned out that science was right (or at least much closer to the mark) than religion. Has anyone got a definitive example of a controversy between a scientific conclusion and a religious illusion where the religious illusion turned out, in the end, to be closer to reality? I can't think of a single one.

 

[Sas]

<removed link>

someone already beat me to the link. Dunno how I missed it reading over the last few pages.

 

[gary-ramey]

Ahh, creationist tactic #7 - take things out of context, as to twist them to say what you want them to. I think the formal term, for this type of logical error, is a "lie by omission".

Here's the actual interview:
Online NewsHour: Conversation with Stephen Jay Gould -- November 26, 1996

As you can clearly see, Gould was talking about the inherent misunderstanding of the general public of how evolution works.

I'd also point out that even in the twisted version you provided did he did not make any sort of claim that abiogenesis and evolution were the same thing - in fact, he quite clearly delineated them as two different processes, one (evolution) occurring after, and only after, the other (abiogenesis).

Nor would anyone familiar with Goulds works, or writing, make the conclusion you came to, as Gould was one of the loudest speakers of his generation on the topics of abiogenesis and evolution, and was quite adamant they were separate things.

Now, once again I'm certain you won't read this, but if you read Goulds "Rock of Ages" you'll see several cases where he makes the distinction. Likewise, here's something else you won't read, but this page contains a large library of essays on his works and views:

Unofficial SJG Archive - Library

Bryan

You're being disingenuious or you didn't read it thoroughly. The interviewer followed up on the statement by Gould "Evolution is..." with the question "what is it then". Gould then goes on to explain what evolution is (in a nutshell) along with explaining the common person's inability to understand how a very complex animal came into being. You might ought to read that again. Furthermore it illustrates the difference of opinions that exist amongst the experts of evolution.

 

[H2Andy]

the common person's inability to understand how a very complex animal came into being

a LOT of very tiny changes over a LOOOOOOOOOOOONG time

we know (for a fact) that populations change over time. we know, thanks to the fossil record, that populations change A LOT over a LONG time ... and DNA tells us that everything goes back to some very simple building blocks that become evolutions on a theme (no pun intended)

it's not hard to understand, and the evidence supports it. sorry for those who can't ideologically accept it without understanding it is a very, very simple process

and it is very possible that if there is a God, evolution is the mechanism he chose to arrive at a very thriving and varied spectrum of life

or are you saying that it is impossible for God to initiate evolution and let it do its thing?